NGS - Next Generation Sequencing
Using the high-throughput sequencing technology, we are able to rapidly identify the mutations underlying rare diseases.
Click here to access our NGS list
A broad variety of disease-related genes
High-tech equipment and a experienced team enable us to offer the analysis of a huge number of disease-related genes.
See our full gene list
COVID-19 Analysis
Genomic Surveillance for SARS-CoV-2 Variants – By sequencing the whole SARS-CoV-2 genome we can identify all variants of concern and all variants that might become relevant in the future.
Learn more
CATCCCATCTCCAATCCAAAT

NGS panel

From carefully selected panels for certain hereditary genetic conditions to clinical exome

NGS panel

Access a complete list of available NGS panels
NGS panels
GCCCAT

Single gene

Sanger sequencing established for more than 600 genes, gene not found > please ask!

Single gene

See the complete list of disease-related genes available for Sanger Sequencing and CNV analysis
Gene list

CNV

Detection of copy number variation (CNV) by MLPA (MRC Holland) and other methods

CNV

See our Gross Genomic Duplications and Deletions page for more detail
CNV

Repeat Expansion

Detection of Repeat Expansion by fragment lenght, sequence and repeat-primed analyses

Repeat Expansion

See our analysis page for more detail
Repeat Expansion
CCA

cDNA

Evaluation of exon skipping or aberrant splicing for potential splice site mutations

cDNA

See our cDNA analysis page for more details
cDNA

Liquid Biopsy

Tracking mutations in cell-free (cf) circulating tumour (ct) DNA of cancer patients

Liquid Biopsy

See our cfDNA analysis page for more details
cfDNA

COVID-19

Sequence analysis of the whole SARS-CoV-2 genome or defined regions

COVID-19 analysis

See our analysis page for more details
COVID-19

Microsatellites

Fluorescence-based fragment analysis for Microsatellite instability or LOH in tumor cells

Microsatellite

See our analysis page for more details
Microsatellites

Medical and Scientific Genetic Analyses Dresden

MEWIGEN runs a molecular genetic laboratory located in Dresden, a growing research hot spot in Germany. As founders have its personal roots in genomic and tumor research itself (see reference list), MEWIGEN provides a wide range of molecular genetic services related to human and tumor genetics for health care professionals successfully now for more than 10 years.

Our services include Sanger Sequencing of more than 600 genes of the human genome associated with hereditary diseases and of many more genes in diverse diagnostic panels by Next Generation Sequencing (NGS). Moreover, we offer cDNA analyses for the clarification of potential splice site mutations, fluorescence-based fragment length analyses (microsatellites, various trinucleotide repeat expansions such as Huntington’s and Ataxias) as well as analyses for gross genomic deletions and duplications and aberrant methylation of relevant sites. The range of our diagnostic spectrum is continuously expanded.

As part of the Federal Ministry of Education and Research (BMBF)-funded innovative growth core PRÆMED.BIO MEWIGEN is working on the identification of therapy-relevant biomarkers for head and neck (HNSCC) and rectal cancer. For this purpose we establish detection of markers in circulating tumor DNA (ctDNA). Challenges of such analyses result from both, the low amount of cell free DNA (cfDNA) and the low proportion of circulating tumor DNA (ctDNA) in the cfDNA.The technique allows sampling of information during surveillance periods (appearance of resistance mutations and disease relapse) and further possibilities in a non-invasive way (e.g. early recognition of disease, choice of therapy).

Gene analysis register

Visit our regularly updated gene register of genetic tests

Funding and supporter

BMBF_CMYK_Gef_M [Konvertiert]

The Innovative Regional Growth Cores (German: Innovative regionale Wachstumskerne) PRÆMED.BIO is a project sponsored by the Ferderal Ministry of Education and Research.

MEWIGEN is supported and receives funding by the German Federal Ministry of Education and Research and the BMBF innovation initiative “Entrepreneurial Regions – The BMBF Innovation Initiative for the New German Länder” (“Unternehmen Region”) to promote regional innovation alliances in Eastern Germany.

Contact MEWIGEN

Contact MEWIGEN